Searches , social queries for H TM-NH
Search references for H TM-NH. Phrases containing H TM-NH
See searches and references containing H TM-NH!
Search references for H TM-NH. Phrases containing H TM-NH
See searches and references containing H TM-NH!H TM-NH
Inorganic radical with the chemical formula NH
production, and chemical products of NH. It reacts with nitric oxide (NO): NH + NO → N2 + OH NH + NO → N2O + H The former reaction is more favorable
Imidogen
Electron in the outer shell of an atom's energy levels
form a shared pair (e.g., in the molecule H–F, the line represents a shared pair of valence electrons, one from H and one from F).[citation needed] Within
Valence_electron
Chemical reaction between an acid and a base
hydroxide, and ammonium and amide, respectively: 2 H 2 O ↽ − − ⇀ H 3 O + + OH − 2 NH 3 ↽ − − ⇀ NH 4 + + NH 2 − {\displaystyle {\begin{aligned}{\ce {2 H2O}}&{\ce
Acid–base_reaction
Early synthetic polymer developed as a textile fiber
[NH−(CH2)6−NH−CO−(CH2)4−CO]n−[NH−(CH2)5−CO]m made from caprolactam, hexamethylenediamine and adipic acid; PA 66/610: [NH−(CH2)6−NH−CO−(CH2)4−CO]n−[NH
Nylon
Six noble, precious metallic elements clustered together in the periodic table
family, or platinum-group elements (PGEs). Renner, H.; Schlamp, G.; Kleinwächter, I.; Drost, E.; Lüschow, H. M.; Tews, P.; Panster, P.; Diehl, M.; et al. (2002)
Platinum_group
Hydrocarbon compound (HC≡CH)
bonds. Since acetylene is a linear symmetrical molecule, it possesses the D∞h point group. At atmospheric pressure, acetylene cannot exist as a liquid and
Acetylene
Measure of the size of an atom
monthly journal of theoretical, analytical and technical chemistry. C. F. & W. H. Chandler. 1877. Bragg, W. L. (1920). "The arrangement of atoms in crystals"
Atomic_radius
Chemical compound
molecules, with a short covalent H–F bond of 95 pm length, are linked to neighboring molecules by intermolecular H–F distances of 155 pm. Liquid HF also
Hydrogen_fluoride
Chemical compound
Diimide, also called diazene or diimine, is a compound having the formula HN=NH. It exists as two geometric isomers, E (trans) and Z (cis). The term diazene
Diimide
Physical and chemical properties of pure water
an H+ ion from HCl when hydrochloric acid is formed: HCl (acid) + H 2O (base) ⇌ H 3O+ + Cl− In the reaction with ammonia, NH 3, water donates a H+ ion
Properties_of_water
Drug of the fibrate class, mainly used to reduce cholesterol levels
03.013. PMID 22709833. Keech AC, Mitchell P, Summanen PA, O'Day J, Davis TM, Moffitt MS, et al. (November 2007). "Effect of fenofibrate on the need for
Fenofibrate
Heat- and wear-resistant metals
210A. doi:10.1080/10667857.2004.11753087. Moxson, V. S.; (Sam) Froes, F. H. (2001). "Fabricating sports equipment components via powder metallurgy".
Refractory_metals
Problem in probability theory
the Chebyshev inequality: P ( | T − n H n | ≥ c n ) ≤ π 2 6 c 2 . {\displaystyle \operatorname {P} \left(|T-nH_{n}|\geq cn\right)\leq {\frac {\pi ^{2}}{6c^{2}}}
Coupon_collector's_problem
Chemical compound
that fluoroantimonic acid consists of a mixture of HF-solvated protons, [(HF)nH]+ (such as H3F+2), and SbF5-adducts of fluoride, [(SbF5)nF]− (such as Sb4F−21)
Fluoroantimonic_acid
Acyclic saturated hydronitrogens
side-chains, or radicals with the general chemical formula N nH n+1. Examples include azanyl (NH 2) and hydrazinyl. This group is generally abbreviated with
Azane
Chemical compound
1248/cpb.52.916. PMID 15304982. Raffa RB, Beckett JR, Brahmbhatt VN, Ebinger TM, Fabian CA, Nixon JR, et al. (June 2013). "Orally active opioid compounds
7-Acetoxymitragynine
Chemical compound
Tm + 3 HgI2 → 2 TmI3 + 3 Hg Tm + HgI2 → TmI2 + Hg Tm + 2 TmI3 → 3 TmI2 Shihua, Wang; Yaping, Gu; Shengbang, Jiang (1987). "FORMATION MECHANISM OF TmI2
Thulium(II)_iodide
Chemical compound; strongest known acid
It has been shown to protonate O2, NH3, SO2, H2O, and CO2, giving HO+ 2, NH+ 4, HSO+ 2, H3O+, and HCO+ 2 respectively. Other molecules such as nitric
Helium_hydride_ion
Variety of climbing fig
Schaefer W, Withers TM (eds) Biology, ecology and evolution of gall-inducing arthropods. Science Publishers, Inc., Enfield (NH) USA, Plymouth (UK), pp
Ficus_pumila_var._awkeotsang
Geologic eon, 4567–4031 million years ago
1334D. doi:10.1126/science.1216066. PMID 22422979. S2CID 206538532. Harrison, TM (2009). "The Hadean crust: evidence from> 4 Ga zircons". Annual Review of
Hadean
Chemical compound hydrogen phosphide
pyramidal molecule with C3v molecular symmetry. The length of the P−H bond is 1.42 Å, the H−P−H bond angles are 93.5°. The dipole moment is 0.58 D, which increases
Phosphine
US military truck
Estrella Warbird Museum". TM 10-1435 Maintenance Manual for Ford GTB (G622) 1 1⁄2-ton 4×4 truck, 20 August 1942 edition. 181 pages. TM 10-1434 Illustrated Parts
Ford_GTB
Spectroscopic technique
doi:10.1002/9780470602539.ch2. ISBN 9780470602539. Schuenemann, V.; Paulsen, H. (2007-12-10). "Mössbauer spectroscopy". In Scott, Robert A.; Lukehart, Charles
Mössbauer_spectroscopy
Chemical compound
⇌ NH+4 + NH−2 Ammonia often functions as a weak base, so it has some buffering ability. Shifts in pH will cause more or fewer ammonium cations (NH+4)
Ammonia
Chemical compound
tetraoxidanes also exist. Tetraoxidane autoionizes when in liquid form: H2O4 ⇌ H+ + HO−4 2 H2O4 ⇌ H3O+4 + HO−4 Hydrogen polyoxide Mckay, Daniel J.; Wright
Tetraoxidane
Poisonous and flammable gas
enzymatic or non-enzymatic pathways. Three enzymes catalyze formation of H 2S: cystathionine γ-lyase (CSE), cystathionine β-synthetase (CBS), and 3-mercaptopyruvate
Hydrogen_sulfide
Chemical compounds containing only hydrogen and one other chemical element
Gagliardi, Laura (28 February 2008). "Infrared Spectra of ThH 2, ThH 4, and the Hydride Bridging ThH 4(H 2) x (x = 1−4) Complexes in Solid Neon and Hydrogen"
Binary_compounds_of_hydrogen
Chemical compound
(YbI3)". pubchem.ncbi.nlm.nih.gov. Asprey, L. B.; Keenan, T. K.; Kruse, F. H. Preparation and crystal data for lanthanide and actinide triiodides. Inorg
Ytterbium(III)_iodide
Theory in historical linguistics
law in Proto-Germanic (PIE *n̥h₃we → PPGmc *ungwe → PGmc *unki, "us two"). Rasmussen chose a consonantal realization for *h₃ as a voiced labialized velar
Laryngeal_theory
Chemical compound with hydrogen and pnictogen atoms
Imidogen, a radical composed of one hydrogen atom and one nitrogen atom (NH), can be classed as a pnictogen hydride. Chemistry portal Ammonium Hydrazoic
Pnictogen_hydride
Chemical compound
with the chemical formula H2O3 or O(OH)2 (can be also written as H[O]3H or [H(μ-O3)H]). It is one of the unstable hydrogen polyoxides. In aqueous solutions
Trioxidane
Chemical compound
Rubidium hydride is the hydride of rubidium. With the formula RbH, it is classified as an alkali metal hydride. It is a white solid and is insoluble in
Rubidium_hydride
Chemical compound
Mt Ds Rg Cn Nh Fl Mc Lv Ts Og ↓ LaI2 LaI3 CeI2 CeI3 PrI2 PrI3 NdI2 NdI3 PmI3 SmI2 SmI3 EuI2 EuI3 GdI2 GdI3 TbI3 DyI2 DyI 3 HoI3 ErI3 TmI2 TmI3 YbI2 YbI3
Samarium(II)_iodide
Hydrocarbon compound with the formula C8H18
Solubilities Database". Srdata.nist.gov. Retrieved May 27, 2026. Dymond, J. H.; Oye, H. A. (1994). "Viscosity of Selected Liquid n-Alkanes". Journal of Physical
Octane
Chemical compound
hydrogen astatide sample can undergo the following reaction: 2 HAt → H+ + At− + H− + At+ → H2 + At2 This results in elemental hydrogen gas and astatine
Hydrogen_astatide
Chemical compound
TmH2 TmH3 YbH2 Actinide hydrides AcH2 ThH2 ThH4 Th4H15 PaH3 UH3 UH4 NpH2 NpH3 PuH2 PuH3 AmH2 AmH3 CmH2 BkH2 BkH3 CfH2 CfH3 Exotic matter hydrides PsH
1-Butene
Chemical compound
the hydroperoxyl radical exist in equilibrium in aqueous solution: • O− 2 + H 2O ⇌ HO• 2 + HO− The pKa of HO2 is 4.88. Therefore, about 0.3% of any superoxide
Hydroperoxyl
log ( N X / N H ) + 12.00 {\displaystyle \epsilon _{X}\equiv \log(N_{X}/N_{H})+12.00} for number density N {\displaystyle N} ; ϵ H = 12.00 {\displaystyle
Abundance of the chemical elements
Abundance_of_the_chemical_elements
Orthography of the Catalan language
pronounced with gemination or not, ⟨tm⟩ and ⟨tll⟩ are only geminated in very formal registers. In Catalan ⟨tl⟩, ⟨tll⟩, ⟨tm⟩ and ⟨tn⟩ are geminated in careful
Catalan_orthography
Chemical compound
Hydrogen chloride is a diatomic molecule, consisting of a hydrogen atom H and a chlorine atom Cl connected by a polar covalent bond. The chlorine atom
Hydrogen_chloride
Chemical compound
PMID 1126056. S2CID 41794868. Göbel M, Klapötke TM (August 2007). "First structural characterization of guanidine, HN=C(NH(2))(2)". Chemical Communications. 43 (30):
Guanidine
Class of chemical compounds
of Boron and Silicon. New York: Cornell University Press. Longuet-Higgins, H. C.; Bell, R. P. (1943). "64. The Structure of the Boron Hydrides". Journal
Boranes
Chemical compound
Lithium hydride (LiH) is an inorganic compound composed of lithium and hydrogen. This alkali metal hydride is a colorless solid, although commercial samples
Lithium_hydride
Chemical compound
and structurally similar to hydrogen selenide, and both are acidic. The H–Te–H angle is about 90°. Volatile tellurium compounds often have unpleasant odours
Hydrogen_telluride
Combining capacity of elements with other atoms
and so is divalent (valence 2), but has oxidation state 0. In acetylene H−C≡C−H, each carbon atom has 4 valence bonds (1 single bond with hydrogen atom
Valence_(chemistry)
Chemical compound
the empirical formula NaH. This alkali metal hydride is primarily used as a strong yet combustible base in organic synthesis. NaH is a saline (salt-like)
Sodium_hydride
Chemical compound
corrosive and, if inhaled, can cause lung damage. Favre, Henri A.; Powell, Warren H., eds. (2014). Nomenclature of Organic Chemistry: IUPAC Recommendations and
Hydrogen_bromide
Chemical compound
Mt Ds Rg Cn Nh Fl Mc Lv Ts Og ↓ LaI2 LaI3 CeI2 CeI3 PrI2 PrI3 NdI2 NdI3 PmI3 SmI2 SmI3 EuI2 EuI3 GdI2 GdI3 TbI3 DyI2 DyI 3 HoI3 ErI3 TmI2 TmI3 YbI2 YbI3
Dysprosium(II)_iodide
groups 6 f-block 167.26 9.066 1802 3141 0.168 1.24 3.5 primordial solid 69 Tm Thulium f-block groups 6 f-block 168.93 9.32 1818 2223 0.16 1.25 0.52 primordial
List_of_chemical_elements
Chemical group (=CH2)
; Milligan, Dolphus E. (1963). "Infrared Study of the Reactions of CH2and NH with C2H2and C2H4in Solid Argon". Journal of the American Chemical Society
Methylene_(compound)
Medication
ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001
Eteplirsen
H 1 3 → 12.32 y He 2 3 + e − H 1 4 → 139 ys H 1 3 + n 0 1 H 1 5 → 86 ys H 1 3 + 2 0 1 n {\displaystyle {\begin{array}{rcl}\\{\ce {^{3}_{1}H}}&{\ce
Isotopes_of_hydrogen
Unstable and toxic chemical compound
unimolecular decomposition at sufficient energy: HN3 → NH + N2 The lowest energy pathway produces NH in the triplet state, making it a spin-forbidden reaction
Hydrazoic_acid
Chemical compound (C6H14)
n-hexane however often contains methylcyclopentane, which features tertiary C-H bonds, which are incompatible with some radical reactions. Inhalation of n-hexane
Hexane
Organic compound (H3C–CH3)
diffraction: rC−C = 1.528(3) Å, rC−H = 1.088(5) Å, and ∠CCH = 111.6(5)° by microwave and rC−C = 1.524(3) Å, rC−H = 1.089(5) Å, and ∠CCH = 111.9(5)° by
Ethane
Chemical compound
reduction of BF3 by sodium hydride (NaH), lithium hydride (LiH) or lithium aluminium hydride (LiAlH4): 8 BF3 + 6 LiH → B2H6 + 6 LiBF4 Lithium hydride used
Diborane
Speakers of Austronesian languages
from the original on 12 April 2019. Retrieved 30 April 2019. Liston J, Rieth TM (2010). "Palau's Petroglyphs: Archaeology, Oral History, and Iconography"
Austronesian_peoples
Chemical compound
atom. Thus, these compounds form a homologous series with chemical formula H 2O n in which the members differ by a constant relative molecular mass of
Hydrogen_polyoxide
Theoretical chemical element with atomic number 119 (Uue)
Steinegger, P.; Abdullin, F. Sh.; et al. (2017). "On the volatility of nihonium (Nh, Z = 113)". The European Physical Journal A. 53 (7): 158. Bibcode:2017EPJA
Ununennium
Chemical class of organic compounds
amino (NH) group via a two-carbon sidechain. Hence, any substituted phenethylamine can be classified according to the substitution of hydrogen (H) atoms
Substituted_phenethylamine
Chemical substance
Mt Ds Rg Cn Nh Fl Mc Lv Ts Og ↓ LaI2 LaI3 CeI2 CeI3 PrI2 PrI3 NdI2 NdI3 PmI3 SmI2 SmI3 EuI2 EuI3 GdI2 GdI3 TbI3 DyI2 DyI 3 HoI3 ErI3 TmI2 TmI3 YbI2 YbI3
Chromium_tetraiodide
Chemical compound
TmH2 TmH3 YbH2 Actinide hydrides AcH2 ThH2 ThH4 Th4H15 PaH3 UH3 UH4 NpH2 NpH3 PuH2 PuH3 AmH2 AmH3 CmH2 BkH2 BkH3 CfH2 CfH3 Exotic matter hydrides PsH
Nonane
Colorless flammable liquid with an ammonia-like odor
is 1.447(2) Å (144.7(2) pm), the N-H distance is 1.015(2) Å, the N-N-H angles are 106(2)° and 112(2)°, the H-N-H angle is 107°. The molecule adopts a
Hydrazine
Chemical compound (SiH4)
silicon. The Si–H bond strength is around 384 kJ/mol, which is about 20% weaker than the H–H bond in H2. Consequently, compounds containing Si–H bonds are much
Silane
Chemical compound
Haynes, p. 9.65 Yoshiasa, A.; Koto, K.; Kanamaru, F.; Emura, S.; Horiuchi, H. (1987). "Anharmonic thermal vibrations in wurtzite-type AgI". Acta Crystallographica
Silver_iodide
Group of genetic disorders resulting in fragile bones
Brizola E, Mattos EP, Ferrari J, Freire PO, Germer R, Llerena JC, Félix TM (October 2015). "Clinical and Molecular Characterization of Osteogenesis Imperfecta
Osteogenesis_imperfecta
Chemical compound
TmH2 TmH3 YbH2 Actinide hydrides AcH2 ThH2 ThH4 Th4H15 PaH3 UH3 UH4 NpH2 NpH3 PuH2 PuH3 AmH2 AmH3 CmH2 BkH2 BkH3 CfH2 CfH3 Exotic matter hydrides PsH
Trihydrogen_oxide
Hydrocarbon compound (H2C=CH2)
by a double bond. All six atoms that comprise ethylene are coplanar. The H-C-H angle is 117.4°, close to the 120° for ideal sp² hybridized carbon. The
Ethylene
Form of water
water (deuterium oxide, 2 H 2O, D 2O) is a form of water in which all hydrogen atoms are hydrogen-2 isotope or deuterium (2 H or D, also known as heavy
Heavy_water
Tabular arrangement of the chemical elements
chemical symbol; those for hydrogen, helium, and lithium are respectively H, He, and Li. Neutrons do not affect the atom's chemical identity, but do affect
Periodic_table
H.; Yang, W. Q.; Chen, R. F.; Zhang, H. B.; Lu, Z. W.; Xu, X. X.; Duan, L. M.; Yang, H. R.; Huang, W. X.; Liu, Z.; Zhou, X. H.; Zhang, Y. H.; Xu, H.
Isotopes_of_uranium
Alkane hydrocarbon; component of gasoline (petrol) and kerosene
conductivity - nonmetallic liquids and gases. Data book. 1970. Dymond, J. H.; Oye, H. A. (1994). "Viscosity of Selected Liquid n-Alkanes". Journal of Physical
Decane
Chemical compound
(October 2022). "Effect of Magnetic Impurities on Superconductivity in LaH 10". Advanced Materials. 34 (42) e2204038. arXiv:2203.06500. Bibcode:2022AdM
Lanthanum_decahydride
Alkyne hydrocarbon compound with three carbon atoms
the original (PDF) on 2006-01-10. Michael J. Taschner; Terry Rosen; Clayton H. Heathcock (1990). "Ethyl Isocrotonate". Organic Syntheses; Collected Volumes
Propyne
Earth's most severe extinction event
3.CO;2. Becker L, Poreda RJ, Basu AR, Pope KO, Harrison TM, Nicholson C, Iasky R (2004). "Bedout: a possible end-Permian impact crater
Permian–Triassic extinction event
Permian–Triassic_extinction_event
Chemical compound
in air to obtain TmOI. Its anhydrous form can be heated with thulium to obtain TmI2: 2 TmI3 + Tm → 3 TmI2 王世华,谷亚平,蒋盛邦.在Tm-HgI2体系中TmI2生成机理[J].物理化学学报,1987(03):334-336
Thulium(III)_iodide
Critical protein in embryonic development
PMID 7753196. S2CID 4362006. Ericson J, Morton S, Kawakami A, Roelink H, Jessell TM (November 1996). "Two critical periods of Sonic Hedgehog signaling required
Sonic_hedgehog_protein
Localized enlargement of the abdominal aorta
(2): 183–196. doi:10.1016/j.crad.2014.09.010. PMID 25443774. Bunce NH, Ray R, Patel H (2020). "30. Cardiology". In Feather A, Randall D, Waterhouse M (eds
Abdominal_aortic_aneurysm
2017 tennis event results
H-y Ng (SIN) 0 2 5 DA Susanto (INA) J Barki (INA) 6 6 1 Sa Ratiwatana (THA) So Ratiwatana (THA) 6 6 4 NH Lý (VIE) TH Nguyễn (VIE) 0 2 4 NH Lý (VIE)
Tennis at the 2017 SEA Games – Men's doubles
Tennis_at_the_2017_SEA_Games_–_Men's_doubles
Alkane with 5 carbon atoms C5H12
Ga2H6 Indiganes InH3 In2H6 Thallanes TlH3 Tl2H6 Nihonanes (predicted) NhH NhH3 Nh2H6 NhH5 Group 14 hydrides Hydrocarbons alkanes alkenes alkynes Cycloalkanes
Pentane
Chemical compound
Andrews, Lester; Wang, Xuefeng (28 March 2003). "The Infrared Spectrum of Al 2 H 6 in Solid Hydrogen". Science. 299 (5615): 2049–2052. doi:10.1126/science
Dialane
French engineer (1849–1932)
Er Tm Yb Lu Hf Ta W Re Os Ir Pt Au Hg Tl Pb Bi Po At Rn Fr Ra 5f 6d 7p 8s Ac Th Pa U Np Pu Am Cm Bk Cf Es Fm Md No Lr Rf Db Sg Bh Hs Mt Ds Rg Cn Nh Fl
Charles_Janet
Chemical compound
RbI7 and RbI9, but this has been refuted by recent studies. Wells, H. L.; Wheeler, H. L.; Penfield, S. L. (1892). "Über Trihalogenverbindungen des Rubidiums
Rubidium_triiodide
Chemical compound (C5H10)
TmH2 TmH3 YbH2 Actinide hydrides AcH2 ThH2 ThH4 Th4H15 PaH3 UH3 UH4 NpH2 NpH3 PuH2 PuH3 AmH2 AmH3 CmH2 BkH2 BkH3 CfH2 CfH3 Exotic matter hydrides PsH
Pentene
Term used for certain metallic elements
Booth H. S. 1957, Inorganic Syntheses, vol. 5, McGraw-Hill, New York. Bradl H. E. 2005, "Sources and origins of heavy metals", in Bradl H. E. (ed.)
Heavy_metals
Chemical compound
synthesis method involves bombarding germanium metal with hydrogen atoms (H) that are generated using a high frequency plasma source to produce germane
Germane
Form of water
D.A.; Perrin, A.; Rinsland, C.P.; Schroeder, J.; Smith, K.M.; Smith, M.A.H.; Tang, K.; Toth, R.A.; Vander Auwera, J.; Varanasi, P.; Yoshino, K. (November
Deuterium-depleted_water
Chemical compound
2016. Retrieved 3 March 2016. Wilgus TA, Bergdall VK, Dipietro LA, Oberyszyn TM (2005). "Hydrogen peroxide disrupts scarless fetal wound repair". Wound Repair
Hydrogen_peroxide
Chemical compound
moist air and oxygen. Philip A. Sellers, Sherman Fried, Robert E. Elson, W. H. Zachariasen (December 1954). "The Preparation of Some Protactinium Compounds
Protactinium_trihydride
Medication used to treat ADHD
S2CID 18339166. Udvardi PT, Föhr KJ, Henes C, Liebau S, Dreyhaupt J, Boeckers TM, et al. (2013). "Atomoxetine affects transcription/translation of the NMDA
Atomoxetine
American psychologist (1925–2022)
Anderson, N. H. A Simple Model for Information Integration. In R.P. Abelson E. Aronson, W.J. McGuire, T.M. Newcomb, M.J. Rosenberg & P.H. Tannenbaum (Eds
Norman H. Anderson (psychologist)
Norman_H._Anderson_(psychologist)
ISBN 0-900416-32-7.: A.H. Gardiner, Catalogue of the Egyptian hieroglyphic printing type, from matrices owned and controlled by Dr. Alan (1928). A.H. Gardiner, "Additions
List_of_Egyptian_hieroglyphs
Anti-diabetic and anti-obesity medication
October 2021. Willard FS, Douros JD, Gabe MB, Showalter AD, Wainscott DB, Suter TM, et al. (September 2020). "Tirzepatide is an imbalanced and biased dual GIP
Tirzepatide
Arithmetic operation
1016/0315-0860(90)90048-i. Department of the Army (1961). Army Technical Manual TM 11-684: Principles and Applications of Mathematics for Communications-Electronics
Addition
2024 tennis event results
3 63 L Musetti 6 3 6 Q G Mpetshi Perricard 6 77 Q G Mpetshi Perricard 4 5 TM Etcheverry 4 6 3 WC B Harris 6 7 WC B Harris 6 3 6 WC B Harris 3 5 WC D Evans
2024 Queen's Club Championships – Singles
2024_Queen's_Club_Championships_–_Singles
Personality construct
(1): 109–18. doi:10.1348/135532508X284310. Williams KM, Cooper BS, Howell TM, Yuille JC, Paulhus DL (2008). "Inferring Sexually Deviant Behavior from Corresponding
Psychopathy
American Army four wheel drive truck
symbol NG - panel body, see also K-51, and K-70 van Model G7106 book symbol NH - dump body, less winch (9,008 built without a winch) Model G7107 book symbol
Chevrolet_G506
Chemical element with atomic number 112 (Cn)
Steinegger, P.; Abdullin, F. Sh.; et al. (2017). "On the volatility of nihonium (Nh, Z = 113)". The European Physical Journal A. 53 (7): 158. Bibcode:2017EPJA
Copernicium
Flammable organic fuel (C4H10)
differing bond dissociation energies: 425 and 411 kJ/mol for the two types of C-H bonds. Normal butane can be used for gasoline blending, as a fuel gas, fragrance
Butane
Chemical compound
A. (5 October 2013). "Theoretical characterization of hydrogen pentoxide, H 2 O 5". International Journal of Quantum Chemistry. 113 (19): 2206–2212. doi:10
Pentaoxidane
travel, tourism, insurance
H TM-NH
H TM-NH
H TM-NH
H TM-NH
H TM-NH
H TM-NH
H TM-NH
H TM-NH
H TM-NH
travel, tourism, insurance