Searches , social queries for RECOGNITION SEQUENCE
Search references for RECOGNITION SEQUENCE. Phrases containing RECOGNITION SEQUENCE
See searches and references containing RECOGNITION SEQUENCE!
Search references for RECOGNITION SEQUENCE. Phrases containing RECOGNITION SEQUENCE
See searches and references containing RECOGNITION SEQUENCE!RECOGNITION SEQUENCE
DNA sequence (or subset thereof), to which the domain is specific
A recognition sequence is a DNA sequence to which a structural motif of a DNA-binding domain exhibits binding specificity. Recognition sequences are palindromes
Recognition_sequence
Type of amino acid sequence
A nuclear localization sequence, or signal (NLS) is an amino acid sequence motif that 'tags' a protein for import into the cell nucleus by nuclear transport
Nuclear_localization_sequence
Restriction enzyme
enzyme isolated from the bacterium Nocardia otitidis. Palindromic recognition sequence of NotI: 5'-GCGGCCGC-3' 3'-CGCCGGCG-5' The ends generated by NotI
NotI
Class of enzymes which cleave nucleic acids
example, the nuclease EcoRI has the recognition sequence 5'—GAATTC—3'. When the enzyme encounters this sequence, it cleaves each backbone between the
Nuclease
Class of enzymes that divide DNA
enzymes recognize a specific sequence of nucleotides and produce a double-stranded cut in the DNA. The recognition sequences can also be classified by the
Restriction_enzyme
Automated recognition of patterns and regularities in data
make predictions about unknown events Prior knowledge for pattern recognition Sequence mining – Data mining techniquePages displaying short descriptions
Pattern_recognition
Restriction enzyme
molecular biology, it is commonly used as a restriction enzyme. Recognition sequence of NdeI: 5'CATATG 3'GTATAC The ends generated by NdeI digest: 5'---CA
NdeI
Restriction enzyme
negative species, Providencia stuartii. PstI cleaves DNA at the recognition sequence 5′-CTGCA/G-3′ generating fragments with 3′-cohesive termini. This
PstI
Restriction enzyme
EcoRV forms a homodimer in solution before binding and acting on its recognition sequence. Initially the enzyme binds weakly to a non-specific site on the
EcoRV
Video game genre
problem-solving skills, including logic, pattern recognition, sequence solving, spatial recognition, and word completion. Many puzzle games involve a
Puzzle_video_game
Restriction enzyme
by Newman, et al. (1995). BamHI binds at the recognition sequence 5'-GGATCC-3', and cleaves these sequences just after the 5'-guanine on each strand. This
BamHI
Self-stabilizing region of a protein that binds to specific DNA sequences
or single-stranded DNA. A DBD can recognize a specific DNA sequence (a recognition sequence) or have a general affinity to DNA. Some DNA-binding domains
DNA-binding_domain
Type of enzyme
functional attribute to the host organism. Homing endonuclease recognition sequences are long enough to occur randomly only with a very low probability
Homing_endonuclease
Enzymes which cleave a nucleotide chain
Endonucleases differ from exonucleases, which cleave the ends of recognition sequences instead of the middle (endo) portion. Some enzymes known as "exo-endonucleases"
Endonuclease
Restriction enzyme
AATT. The nucleic acid recognition sequence where the enzyme cuts is G↓AATTC, which has a palindromic complementary sequence of CTTAA↓G. EcoRI was one
EcoRI
Automatic conversion of spoken language into text
Speech recognition (automatic speech recognition (ASR), computer speech recognition, or speech-to-text (STT)) is a sub-field of computational linguistics
Speech_recognition
DNA or RNA sequence that matches its complement when read backwards
A palindromic sequence is a nucleic acid sequence in a double-stranded DNA or RNA molecule whereby reading in a certain direction (e.g. 5' to 3') on one
Palindromic_sequence
type of restriction enzyme that has a long or uncommon recognition sequence. Since these sequences don't appear often in genomes, the enzyme cleaves DNA
Rare-cutter_enzyme
Class of transposable elements that cause hybrid dysgenesis in eukaryotes
Naturally-occurring P elements contain coding sequence for the enzyme transposase and recognition sequences for transposase action. Transposase regulates
P_element
sequence labeling is a type of pattern recognition task that involves the algorithmic assignment of a categorical label to each member of a sequence of
Sequence_labeling
Deliberate fragmentation of DNA in preparation for analysis
twelve-nucleotide sequence, recognition sequences tend to occur by chance in any long sequence. Restriction enzymes specific to hundreds of distinct sequences have
Restriction_digest
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: T–Z
List_of_restriction_enzyme_cutting_sites:_T–Z
Molecular cloning method for DNA assembly
DNA outside of their recognition sites and, therefore, can create non-palindromic overhangs. Since 256 potential overhang sequences are possible, multiple
Golden_Gate_Cloning
Class of chemical compounds
also differ from other RiPPs based on the presence of a C-terminal recognition sequence in addition to the N-terminal leader peptide (MSDIN). α-Amanitin
Ribosomally synthesized and post-translationally modified peptides
Ribosomally_synthesized_and_post-translationally_modified_peptides
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: Ba–Bc
List_of_restriction_enzyme_cutting_sites:_Ba–Bc
enzyme. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: A
List_of_restriction_enzyme_cutting_sites:_A
Pair of restriction enzymes
recognition sequence. The term is derived from Greek iso 'same' and skihzo 'to split'. The first enzyme discovered which recognizes a given sequence is
Isoschizomer
Family of machine learning approaches
models, speech recognition, and text summarization. Seq2seq uses sequence transformation: it turns one sequence into another sequence. One naturally wonders
Seq2seq
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: E–F
List_of_restriction_enzyme_cutting_sites:_E–F
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: Bsa–Bso
List_of_restriction_enzyme_cutting_sites:_Bsa–Bso
DNA region at which restriction enzymes cleave
sites, or restriction recognition sites, are regions of a DNA molecule containing specific (4-8 base pairs in length) sequences of nucleotides; these
Restriction_site
specific DNA sequence, usually short (3 to 8 bp), and cut it, producing either blunt or overhung ends, either at or nearby the recognition site. Restriction
List of restriction enzyme cutting sites
List_of_restriction_enzyme_cutting_sites
Study of DNA modifications that do not change its sequence
study of changes in gene expression that occur without altering the DNA sequence. The Greek prefix epi- (ἐπι- "over, outside of, around") in epigenetics
Epigenetics
Restriction enzyme
isolated from the bacterium Thermus aquaticus in 1978. It has a recognition sequence of 5'TCGA 3'AGCT and makes the cut 5'---T CGA---3' 3'---AGC T---5'
TaqI
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: S
List_of_restriction_enzyme_cutting_sites:_S
Strain of bacteria
preventing the methylation of a cytosine on both strands within the recognition sequence 5'-CC(A/T)GG-3'. This facilitates further processing of purified
Escherichia_coli_BL21(DE3)
Pair of restriction enzymes
slightly different recognition sequences, but upon cleavage of DNA, generate identical overhanging termini sequences. These sequences can be ligated to
Isocaudomer
Type of neural network output and associated scoring function
networks on sequence-labelling tasks where the input and output are not aligned in time. It can be used for tasks like on-line handwriting recognition or speech
Connectionist temporal classification
Connectionist_temporal_classification
Computerized information extraction from images
applications, including computer vision, speech recognition, identification of albuminous sequences in bioinformatics, production control, time series
Computer_vision
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: O–R
List_of_restriction_enzyme_cutting_sites:_O–R
Dense cluser of restriction sites in DNA
facilitating blue-white screening for recombinant selection. By including recognition sequences for a variety of restriction enzymes, the MCS greatly enhances flexibility
Multiple_cloning_site
Restriction enzyme
'P', meaning that it has symmetric target and cleavage sites. Its recognition sequence is 5' CGGCG and 3' GCCGGC and its cut is 5' ---C GGCCG--- 3' and
AaaI
Algorithm for measuring similarity between temporal sequences
audio signals. Sequence averaging: a GPL Java implementation of DBA. The Gesture Recognition Toolkit|GRT C++ real-time gesture-recognition toolkit implements
Dynamic_time_warping
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: Bst–Bv
List_of_restriction_enzyme_cutting_sites:_Bst–Bv
Topics referred to by the same term
amoebic meningoencephalitis Protospacer adjacent motif, a genetic DNA recognition sequence PAM graphics format, used by Netpbm PAM library, Parallel Augmented
PAM
are endodeoxyribonucleases characterized by a large recognition site (double-stranded DNA sequences of 12 to 40 base pairs); as a result this site generally
Meganuclease
Mobile genetic element in the primate genome (including human genome)
TATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC. The recognition sequence of the Alu I endonuclease is 5' ag/ct 3'; that is, the enzyme cuts
Alu_element
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: L–N
List_of_restriction_enzyme_cutting_sites:_L–N
Naturally occurring P elements contain: coding sequence for the enzyme transposase; recognition sequences for transposase action. Transposase is an enzyme
Transposons_as_a_genetic_tool
Determining the position and orientation of a robot by analyzing associated camera images
Pattern Recognition: 21–23. Retrieved 7 June 2010. Burger, W.; Bhanu, B. (Nov 1990). "Estimating 3D egomotion from perspective image sequence". IEEE Transactions
Visual_odometry
DNA-editing technology
downstream from the PAM site. This characteristic ensures that the recognition sequence remains intact after repair, enabling Cas12a to perform multiple
Cas12a
Defense system in bacteria and archaea
and methylation. Cleavage occurs at variable distances from the recognition sequence, so discrete bands are not easily visualized by gel electrophoresis
Restriction modification system
Restriction_modification_system
Recognition of events from videos or sensors
fields may refer to activity recognition as plan recognition, goal recognition, intent recognition, behavior recognition, location estimation and location-based
Activity_recognition
Topical guide to object recognition
Object recognition – technology in the field of computer vision for finding and identifying objects in an image or video sequence. Humans recognize a multitude
Outline_of_object_recognition
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: Bsp–Bss
List_of_restriction_enzyme_cutting_sites:_Bsp–Bss
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: C–D
List_of_restriction_enzyme_cutting_sites:_C–D
Process of modifying a gene
structural drawback to unmodified SPAs as gene modulators is that their recognition sequence cannot be extended beyond 5 Watson-Crick base pairings. The natural
Therapeutic_gene_modulation
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: Bd–Bp
List_of_restriction_enzyme_cutting_sites:_Bd–Bp
Computer language processing metric
Word error rate (WER) is a common metric of the performance of a speech recognition or machine translation system. The WER metric typically ranges from 0
Word_error_rate
Group of transcription factors
domain and binding as a dimer to DNA sequences like 5'-TGACGTCA-3' or 5'-TGA(C/G)TCA-3' as recognition sequences. Targeted mutation of the CREB gene:
ATF/CREB
Type of restriction enzymes
Withers, Barbara E.; Dunbar, Joan C. (1995). "DNA determinants in sequence-specific recognition by Xm al endonuclease". Nucleic Acids Research. 23 (17): 3571–3577
Neoschizomer
Family of transcription factors
to specific sequences of DNA with high affinity. Family members contain an unusual DNA binding domain that binds to the recognition sequence 5'-TTGGCXXXXXGCCAA-3'
Nuclear_factor_I
Principal protocol used to stream data across an IP network
receiving port. Sequence Number: 32 bits Has a dual role: If the SYN flag is set (1), then this is the initial sequence number. The sequence number of the
Transmission_Control_Protocol
Database for DNA restriction enzymes
REBASE contains an extensive set of references, sites of recognition and cleavage, sequences and structures. It also contains information on the commercial
REBASE_(database)
Family of restriction endonucleases
and Bse634I recognise the double-stranded sequence RCCGGY and cleave after the purine R. Recognition sequence Cut 5' RCCGGY 5' ---R CCGGY--- 3' 3' YGGCCR
Cfr10I/Bse634I
identity and location of nucleotide sequences. The method involves detecting the location of sequence specific recognition events (e.g., such as hybridization
Positional_sequencing
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: G–K
List_of_restriction_enzyme_cutting_sites:_G–K
Protein-coding gene in humans
cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in
CDH16
Process of locating specific genes
Restriction enzymes are enzymes that help cut segments of DNA at specific recognition sequences. The basis to restriction mapping involves digesting (or cutting)
Gene_mapping
Method of protein structure prediction
In molecular biology, protein threading, also known as fold recognition, is a method of protein modeling which is used to model those proteins which have
Threading_(protein_sequence)
Enzyme
restriction enzyme will form 15-20 hydrogen bonds with the bases of the recognition sequence. With the aid of other van der Waals interactions, this bonding facilitates
HindIII
Protein-coding gene in humans
cadherins are defined based on their lack of an HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin appears to
CDH12
Protein family
elements: the transmembrane domain and a primary sequence motif in or immediately adjacent to it. This recognition motif directs where the substrate is cleaved
Rhomboid_protease
Not all restriction enzymes have the desired specificity for their recognition sequence. Some can recognize and cut single-stranded DNA, and some show a
Oligomer_restriction
Sequence in a genome
bear specialized sequence regions that control origin function. These elements include both DNA sequence-specific origin recognition boxes (ORBs or miniORBs)
Origin_of_replication
Method of biometric identification
Iris recognition is an automated method of biometric identification that uses mathematical pattern-recognition techniques on video images of one or both
Iris_recognition
DNA sequence
molecular biology, the TATA box (also called the Goldberg–Hogness box) is a sequence of DNA found in the core promoter region of genes in archaea and eukaryotes
TATA_box
Modified genetic code
achieved by changing the recognition sequence of the mRNA, the Shine-Dalgarno sequence, and the corresponding recognition sequence in the 16S rRNA of ribosomes
Expanded_genetic_code
Class of enzymes
bipartite DNA recognition sequence. In the presence of the R subunit, the complex can also act as an endonuclease, binding to the same target sequence but cutting
DNA_methyltransferase
Machine learning model for speech
Whisper is a machine learning model for speech recognition and transcription, created by OpenAI and first released as open-source software in September
Whisper (speech recognition system)
Whisper_(speech_recognition_system)
Finds likely sequence of hidden states
bioinformatics. For instance, in speech-to-text (speech recognition), the acoustic signal is the observed sequence, and a string of text is the "hidden cause" of
Viterbi_algorithm
Family of DNA sequences found in prokaryotic organisms
repeats) is a family of DNA sequences found in the genomes of prokaryotic organisms such as bacteria and archaea. Each sequence within an individual prokaryotic
CRISPR
phage: bacteriophage. Recognition sequence: Sequence of DNA recognized by the enzyme. The enzyme is specifically bound to this sequence. Cut: Cutting site
List of homing endonuclease cutting sites
List_of_homing_endonuclease_cutting_sites
Capturing of human-marked data from document forms
configure and select an OMR sequence then apply the OMR marks to mail documents prior to printing. Optical mark recognition (OMR) is the scanning of paper
Optical_mark_recognition
Statistical Markov model
prediction Handwriting recognition Alignment of bio-sequences Time series analysis Activity recognition Protein folding Sequence classification Metamorphic
Hidden_Markov_model
Enzyme
aegyptius bacteria. The enzyme's recognition site—the place where it cuts DNA molecules—is the GGCC nucleotide sequence which means it cleaves DNA at the
HaeIII
Most common variant of a genetic sequence across samples
molecular biology and bioinformatics, the consensus sequence (or canonical sequence) is the calculated sequence of most frequent residues, either nucleotide
Consensus_sequence
Class of artificial neural network
cannot be unrolled. The effect of memory-based learning for the recognition of sequences can also be implemented by a more biological-based model which
Recurrent_neural_network
Class of small RNA molecules
3′ end of the sequence. The hairpin regions contain internal bulges known as recognition loops in which the antisense guide sequences (bases complementary
Small_nucleolar_RNA
Method of human learning
types of sequence learning. There are four basic sequence learning problems: sequence prediction, sequence generation, sequence recognition, and sequential
Sequence_learning
Protein-RNA complex
The signal recognition particle (SRP) is an abundant, cytosolic, universally conserved ribonucleoprotein (protein-RNA complex) that recognizes and targets
Signal_recognition_particle
Type of unintended effects of genetic modification techniques
a Cas9 protein, a recognition sequence RNA, and a transactivating RNA are required. The fusion of both the recognition sequence specificity CRISPR RNA
Off-target_genome_editing
Markov-based processes with variable "memory"
identification of DNA and protein sequences, [1] statistical process control, spam filtering, haplotyping, speech recognition, sequence analysis in social sciences
Variable-order_Markov_model
Short peptide present at N-terminal of newly synthesized proteins
referred to as signal sequence, targeting signal, localization signal, localization sequence, transit peptide, leader sequence or leader peptide) is a
Signal_peptide
Class of statistical modeling methods
natural language processing or biological sequences, part-of-speech tagging, shallow parsing, named entity recognition, gene finding, peptide critical functional
Conditional_random_field
Identification and study of genomic sequences
In bioinformatics, sequence analysis is the process of subjecting a DNA, RNA or peptide sequence to any of a wide range of analytical methods to understand
Sequence_analysis
Restriction enzyme
isoschizomers recognize and cut the same recognition sequence 5’-CATG-3’. Endonucleases that cut at this sequence include: Fael Fatl Hin1II Hsp92II CviAII
NlaIII
Linux software for speech recognition
be used in speech recognition projects. VoxForge accepts crowdsourced speech samples and corrections of recognized speech sequences. It is licensed under
Speech recognition software for Linux
Speech_recognition_software_for_Linux
Protein that regulates the rate of DNA transcription
In molecular biology, a transcription factor (TF) (or sequence-specific DNA-binding factor) is a protein that controls the rate of transcription of genetic
Transcription_factor
Synthetic DNA transposon for vertebrate genetic modification
designated PAI and RED. The PAI subdomain plays a dominant role in recognition of the DR sequences in the transposon. The RED subdomain overlaps with the nuclear
Sleeping Beauty transposon system
Sleeping_Beauty_transposon_system
travel, tourism, insurance
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
Boy/Male
Afghan, German, Indonesian
Fulfilled Wish; Prayer; Recognition; Acceptance
Boy/Male
Indian, Sanskrit
Order; Sequence
Girl/Female
Tamil
Anuloma | அநà¯à®²à¯‹à®®à®¾
Sequence
Anuloma | அநà¯à®²à¯‹à®®à®¾
Surname or Lastname
English
English : from a medieval male personal name (from Latin Hilarius, a derivative of hilaris ‘cheerful’, ‘glad’, from Greek hilaros ‘propitious’, ‘joyful’). The Latin name was chosen by many early Christians to express their joy and hope of salvation, and was borne by several saints, including a 4th-century bishop of Poitiers noted for his vigorous resistance to the Arian heresy, and a 5th-century bishop of Arles. Largely due to veneration of the first of these, the name became popular in France in the forms Hilari and Hilaire, and was brought to England by the Norman conquerors.English : from the much rarer female personal name Eulalie (from Latin Eulalia, from Greek eulalos ‘eloquent’, literally well-speaking, chosen by early Christians as a reference to the gift of tongues), likewise introduced into England by the Normans. A St. Eulalia was crucified at Barcelona in the reign of the Emperor Diocletian and became the patron of that city. In England the name underwent dissimilation of the sequence -l-l- to -l-r- and the unfamiliar initial vowel was also mutilated, so that eventually the name was considered as no more than a feminine form of Hilary (of which the initial aspirate was in any case variable).
Boy/Male
Arabic, Muslim
Praise; Hymn of God; Recognition
Boy/Male
Arabic, Australian, Muslim
Mount of Recognition; Pilgrimage Site 25km from Mecca
Girl/Female
Bengali, Gujarati, Hindu, Indian, Kannada, Malayalam, Marathi, Sanskrit, Telugu
Sequence
Boy/Male
Indian, Sikh
Music; In-sequence
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
travel, tourism, insurance