AI & ChatGPT searches , social queries for THYMINE
Search references for THYMINE. Phrases containing THYMINE
See searches and references containing THYMINE!
Search references for THYMINE. Phrases containing THYMINE
See searches and references containing THYMINE!THYMINE
Chemical compound of DNA
cytosine. Thymine is also known as 5-methyluracil, a pyrimidine nucleobase. In RNA, thymine is replaced by the nucleobase uracil. Thymine was first isolated
Thymine
Molecule that carries genetic information
nitrogen-containing nucleobases (cytosine [C], guanine [G], adenine [A] or thymine [T]), a sugar called deoxyribose, and a phosphate group. The nucleotides
DNA
Type of DNA damage
from a photochemical reaction involving two pyrimidine (P) nucleobases (thymine, cytosine, or uracil) through formation of new covalent bonds. The discovery
Pyrimidine_dimer
Nitrogen-containing biological compounds that form nucleosides
deoxyribonucleic acid (DNA). Five nucleobases—adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U)—are called primary or canonical. They function as the
Nucleotide_base
Chemical compound
Thymine glycol (5,6-dihydroxy-5,6-dihydrothymine) is one of the principal DNA lesions that can be induced by oxidation and ionizing radiation. The rate
Thymine_glycol
Chemical compound of RNA
bonds. In DNA, the uracil nucleobase is replaced by thymine (T). Uracil is a demethylated form of thymine. Uracil is a common and naturally occurring pyrimidine
Uracil
Thymine dioxygenase (EC 1.14.11.6) is an enzyme that catalyzes the chemical reaction thymine Fe(IV)=O Fe(II) 5-hydroxymethyluracil The enzyme oxidises
Thymine_dioxygenase
Aromatic compound (C4H4N2)
three types of nucleobases are pyrimidine derivatives: cytosine (C), thymine (T), and uracil (U). The pyrimidine ring system has wide occurrence in
Pyrimidine
Biological molecules constituting nucleic acids
DNA are guanine, adenine, cytosine, and thymine (G, A, C, and T); in RNA, uracil (U) is used in place of thymine. Nucleotides also play a central role in
Nucleotide
Protein-coding gene in the species Homo sapiens
G/T mismatch-specific thymine DNA glycosylase is an enzyme that in humans is encoded by the TDG gene. Several bacterial proteins have strong sequence
Thymine-DNA_glycosylase
Chemical compound
body] The prefix deoxy- is often left out since there are no precursors of thymine nucleotides involved in RNA synthesis. Before the boom in thymidine use
Thymidine
Class of enzymes
Uracil/thymine dehydrogenase (EC 1.17.99.4, uracil oxidase, uracil-thymine oxidase, uracil dehydrogenase) is an enzyme with systematic name uracil:acceptor
Uracil/thymine_dehydrogenase
Chemical compound in nucleic acids
nucleotide bases found in DNA and RNA, along with adenine, guanine, and thymine (uracil in RNA). It is a pyrimidine derivative, with a heterocyclic aromatic
Cytosine
Chemical compound
5,6-Dihydro-5(α-thyminyl)thymine is a DNA pyrimidine dimer photoproduct produced when DNA in bacterial spores is exposed to ultraviolet light. In bacteria
5,6-Dihydro-5(α-thyminyl)thymine
5,6-Dihydro-5(α-thyminyl)thymine
Chemical compound in DNA and RNA
crystalline subtance. The shape of adenine is complementary and pairs to either thymine in DNA or uracil in RNA. In cells, adenine is rare as an independent molecule
Adenine
Chemical compound of DNA and RNA
the nucleic acids DNA and RNA, the others being adenine, cytosine, and thymine (uracil in RNA). In DNA, guanine is paired with cytosine. The guanine nucleoside
Guanine
Form of electromagnetic radiation
ultraviolet radiation. UVB causes thymine base pairs next to each other in genetic sequences to bond together into thymine dimers, a disruption in the strand
Ultraviolet
Biological process
the pyrimidine ring where the DNA base thymine's methyl group is located; the same position distinguishes thymine from the analogous RNA base uracil, which
DNA_methylation
Removal of an amino group from a molecule
replication fork, can be corrected by the enzyme thymine-DNA glycosylase, which removes the thymine base in a G/T mismatch. This leaves an abasic site
Deamination
Fluorescent stain
6-diamidino-2-phenylindole, is a fluorescent stain that binds strongly to adenine–thymine-rich regions in DNA. It is used extensively in fluorescence microscopy
DAPI
Lock-and-key pairing between two structures
between nucleobases: adenine, thymine (uracil in RNA), guanine and cytosine. Adenine and guanine are purines, while thymine, cytosine and uracil are pyrimidines
Complementarity (molecular biology)
Complementarity_(molecular_biology)
Benzo-homologated DNA analogue
ring and one of the four natural bases: adenine, guanine, cytosine, and thymine. This size expansion produces an 8 letter alphabet which has a larger information
XDNA
Over- or under-abundance of guanine and cytosine in a particular region of DNA or RNA
genome) there is an equal frequency of the four DNA bases (adenine, guanine, thymine, and cytosine) on both single strands of a DNA molecule. However, in most
GC_skew
RNA that is read by the ribosome to produce a protein
where the coding DNA strand contains thymine. Structurally, uracil–adenine (U–A) base pairs closely resemble thymine–adenine (T–A) base pairs, which ensures
Messenger_RNA
Two rules about the percentage of A, C, G, and T in DNA strands
of cytosine and the amount of adenine should be equal to the amount of thymine. Further, a 1:1 stoichiometric ratio of purine and pyrimidine bases (i
Chargaff's_rules
DNA sequence required in bacterial promoters for transcription
Pribnow-Schaller box) is a sequence of TATAAT of six nucleotides (thymine, adenine, thymine, etc.) that is an essential part of a promoter site on DNA for
Pribnow_box
traditional subcloning. The technique relies on the ability of adenine (A) and thymine (T) (complementary basepairs) on different DNA fragments to hybridize and
TA_cloning
1997 film by Andrew Niccol
based on the letters G, A, T, and C, which stand for guanine, adenine, thymine, and cytosine, the four nucleobases of DNA. It was a 1997 nominee for the
Gattaca
Succession of nucleotides in a nucleic acid
RNA, except with U (uracil) replacing T (thymine). Apart from adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U), DNA and RNA also contain
Nucleic_acid_sequence
amplification by polymerase chain reaction, the uracils are converted into thymines. Methylated cytosines are then recognized as cytosines. Their locations
Whole genome bisulfite sequencing
Whole_genome_bisulfite_sequencing
Interplay between observation, experiment, and theory in science
Watson (1968), pp. 194–197: "Suddenly I became aware that an adenine-thymine pair held together by two hydrogen bonds was identical in shape to a guanine-cytosine
Scientific_method
Class of large biomolecules essential to all known life
bases found in RNA and DNA are: adenine, cytosine, guanine, thymine, and uracil. Thymine occurs only in DNA[dubious – discuss] and uracil only in RNA
Nucleic_acid
Two nucleobases bound by hydrogen bonds
(or "Watson–Crick–Franklin") base pairs (guanine–cytosine and adenine–thymine/uracil) allow the DNA helix to maintain a regular helical structure that
Base_pair
Topics referred to by the same term
English personal pronoun thou (archaic) Thy (district), Jutland, Denmark Thymine, one of the four nucleobases in the nucleic acid of DNA Turkish Airlines
Thy
Study of chemical processes of living organisms
binds with thymine and uracil, thymine binds only with adenine, and cytosine and guanine can bind only with one another. Adenine, thymine, and uracil
Biochemistry
Genetic point mutation that results in an amino acid change in a protein
in the DNA sequence (CGT) causing the guanine to be replaced with the thymine, yielding CTT in the DNA sequence. This results at the protein level in
Missense_mutation
American biochemist (1869–1940)
nucleic acid, DNA from RNA, and found that DNA contained adenine, guanine, thymine, cytosine, deoxyribose, and a phosphate group. He was born into a Litvak
Phoebus_Levene
Type of RNA
strands found in cells. It is similar to DNA but with the replacement of thymine by uracil and the adding of one oxygen atom. Despite the structural similarities
Double-stranded_RNA
sequence of ATGAGTCAT, where A corresponds to adenine, T corresponds to thymine, G corresponds to guanine, and C corresponds to cytosine. AP-1 nucleotide
AP-1_binding_site
Chemical compound
mutagen. It acts by adding alkyl groups to the O6 of guanine and O4 of thymine, which can lead to transition mutations between GC and AT. These changes
Methylnitronitrosoguanidine
Biological process
reduce its fidelity. Base analog such as 5-bromouracil may substitute for thymine in replication. Metals such as cadmium, chromium, and nickel can increase
Mutagenesis
Chemical compound
the pyrophosphate group, the pentose sugar ribose, and the nucleobase thymine. Unlike the other deoxyribonucleotides, thymidine diphosphate does not
Thymidine_diphosphate
Epigenetic phenomenon
5hmC to generate 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC). Thymine-DNA glycosylase (TDG) recognizes the intermediate bases 5fC and 5caC and
Reprogramming
Assembly of proteins inside biological cells
adenine and thymine (G, C, A and T). RNA is also composed of four bases: guanine, cytosine, adenine and uracil. In RNA molecules, the DNA base thymine is replaced
Protein_biosynthesis
dUMP, thereby ensuring that the organism's DNA contains the nucleobase thymine instead of uracil. DUT, the human version of this gene dnaA dnaB dnaC dnaE
DnaS
Laboratory technique for DNA methylation profiling
conversion of methylated cytosines, 5mC and 5hmC, to uracil which is read as a thymine after sequencing. Due to direct conversion of methylated bases, TAPS is
TET-assisted pyridine borane sequencing
TET-assisted_pyridine_borane_sequencing
Property of nucleic acid strands with respect to their translatability into protein
translated or translatable into a sequence of amino acids (provided that any thymine bases in the DNA sequence are replaced with uracil bases in the RNA sequence)
Sense_(molecular_biology)
Replication of DNA
units are made up of a nitrogenous base (cytosine, guanine, adenine or thymine), pentose sugar (deoxyribose) and phosphate group. Each unit is joined
DNA_synthesis
Percentage of guanine and cytosine in DNA or RNA molecules
C bases out of an implied four total bases, also including adenine and thymine in DNA and adenine and uracil in RNA. GC-content may be given for a certain
GC-content
Radio message sent into space in 1974
Deoxyribose (C5H7O) Adenine (C5H4N5) Thymine (C5H5N2O2) Deoxyribose (C5H7O) Phosphate (PO4) Phosphate (PO4) Deoxyribose (C5H7O) Cytosine (C4H4N3O) Guanine
Arecibo_message
Enzyme
sugar unit: thymidine Pi Pi 2-deoxy-α-D-ribose 1-phosphate + thymine Thymidine phosphorylase is involved in purine metabolism, pyrimidine metabolism
Thymidine_phosphorylase
Enzymes which cleave a nucleotide chain
Exposure of bacteriophage (phage) T4 to ultraviolet irradiation induces thymine dimers in the phage DNA. The phage T4 denV gene encodes endonuclease V
Endonuclease
Topics referred to by the same term
Goods Act, 1992, a Canadian law Thiodiglycol, an organosulfur compound Thymine-DNA glycosylase, an enzyme Transient directing group in organic chemistry
TDG
Heterocyclic aromatic organic compound
pyrimidines, thymine and cytosine, respectively. This is called complementary base pairing. In RNA, the complement of adenine is uracil instead of thymine. Other
Purine
Process where substrates are converted into more complex products in living organisms
mechanism. In contrast to uracil, thymine bases are found mostly in DNA, not RNA. Cells do not normally contain thymine bases that are linked to ribose
Biosynthesis
given position (for example, 10% Adenine, 75% Guanine, 5% Cytosine & 10% Thymine). As an example, with the degenerate code R = A + G, 50% of the time that
DNA_spiking
Protein-coding gene in Homo sapiens
functions as a molecular switch. In normal DNA, adenine (A) bonds with thymine (T) and cytosine (C) bonds with guanine (G). Sometimes there will be a
MSH6
Science of synthetic life forms
standard A, C and G nucleotides but has the synthetic thymine analogue 5-chlorouracil instead of thymine (T) in the corresponding positions of the sequence
Xenobiology
Product of thymine metabolism
β-aminoisobutyric acid or BAIBA) is a product formed by the catabolism of thymine and valine. During exercise, the increase of PGC-1α protein triggers the
3-Aminoisobutyric_acid
Process of determining the nucleic acid sequence
technology that is used to determine the order of the four bases: adenine, thymine, cytosine, and guanine. The advent of rapid DNA sequencing methods has
DNA_sequencing
Life arising from non-living matter
pyrimidine nucleobases including guanine, adenine, cytosine, uracil, and thymine, as well as sugars, have been found in meteorites. These could have provided
Abiogenesis
Chemical compound
of a phosphate group, the pentose sugar deoxyribose, and the nucleobase thymine. Unlike the other deoxyribonucleotides, thymidine monophosphate often does
Thymidine_monophosphate
G-bands. Darkly colored R bands are guanine-cytosine rich, and adenine-thymine rich regions are more readily denatured by heat. The technique is useful
R‑banding
Cohen in Escherichia coli when thymine-requiring mutants of the bacteria lost viability when grown in a medium lacking thymine but containing other essential
Thymineless_death
Type of enzyme inhibition by forming an irreversible complex with the substrate
as a suicide inhibitor of thymidylate synthase during the synthesis of thymine from uridine. This reaction is crucial for the proliferation of cells,
Suicide_inhibition
Organic compound (CH2)4
coupling of the C=C double bonds of pyrimidines. Thymine dimers (T-T dimers) formed in between two thymines are the most abundant of the CPDs. CPDs are readily
Cyclobutane
Class of enzymes
and break certain types of pyrimidine dimers that arise when a pair of thymine or cytosine bases on the same strand of DNA become covalently linked. The
Photolyase
Chemical compound or ion
is amplified via polymerase chain reaction, the uracil is amplified as thymine and the methylated cytosines are amplified as cytosine. DNA sequencing
Bisulfite
Free radical toxicity
gamma-radiation-induced guanine-thymine and thymine-guanine intrastrand cross-links in mammalian cells and translesion synthesis past the guanine-thymine lesion by human
Oxidative_stress
Class of chemical compounds
bases: adenine, guanine, cytosine and thymine. RNA also contains adenine, guanine, and cytosine, but replaces thymine with uracil. Thus, DNA synthesis requires
Nucleoside_triphosphate
Region of often-methylated DNA with a cytosine followed by a guanine
regulation that is called epigenetics. Methylated cytosines often mutate to thymines. In humans, about 70% of promoters located near the transcription start
CpG_site
One of the five major nucleosides in nucleic acids
lacks a hydroxyl group at the 2' position. 5-Methyluridine contains a thymine base joined to a ribose pentose sugar. It is a white solid. m5U is one
5-Methyluridine
Nuclear genetic code in some flagellates
TCAGTCAGTCAGTCAGTCAG Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U). Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine
Blastocrithidia_nuclear_code
German biochemist and pioneer in the study of genetics
compounds that are present in nucleic acid: adenine, cytosine, guanine, thymine, and uracil. These compounds were later shown to be nucleobases, and are
Albrecht_Kossel
Short piece of synthetic DNA
takes advantage of ASO to detect one base pair difference (cytosine versus thymine) to measure methylation at a specific CpG site. The human disease sickle
Allele-specific oligonucleotide
Allele-specific_oligonucleotide
Method for analyzing DNA methylation using enzymes
uracil (U) through enzymatic conversion before sequencing and read as thymine (T). This enzymatic conversion of cytosine to uracil is achieved through
Enzymatic_methyl-seq
guanine to adenine at base position 1896 (G1896A), and from cytosine to thymine at position 1858 (C1858T) in the precore region of the viral genome. The
Hepatitis B virus precore mutant
Hepatitis_B_virus_precore_mutant
Medical condition
dihydropyrimidine dehydrogenase, an enzyme involved in the metabolism of uracil and thymine. Individuals with this condition may develop life-threatening toxicity
Dihydropyrimidine dehydrogenase deficiency
Dihydropyrimidine_dehydrogenase_deficiency
C5H6IN pyridium iodide 18820-83-2 C5H6N2 glutaronitrile 544-13-8 C5H6N2O2 thymine 65-71-4 C5H6O 2-methylfuran 534-22-5 C5H6O 3-methylfuran 930-27-8 C5H6O
List of compounds with carbon number 5
List_of_compounds_with_carbon_number_5
Chemical compound
5-Ethynyl-2′-deoxyuridine (EdU) is a thymidine analogue which is incorporated into the DNA of dividing cells. EdU is used to assay DNA synthesis in cell
5-Ethynyl-2'-deoxyuridine
DNA or RNA sequence that matches its complement when read backwards
directions, and the nucleotides always pair in the same way (adenine (A) with thymine (T) in DNA or uracil (U) in RNA; cytosine (C) with guanine (G)), a (single-stranded)
Palindromic_sequence
Chemical compound
and the second is the non-intentional incorporation of pyrimidine where thymine belongs in the DNA, resulting in dUMP. UMP synthase deficiency is a metabolic
Deoxyuridine
Stain used for diagnosis of malaria
attaches itself to regions of DNA where there are high amounts of adenine-thymine bonding. Giemsa stain is used in Giemsa banding, commonly called G-banding
Giemsa_stain
Class of enzymes
oxidizes thymine. The enzyme acts on the hydrated derivative of the substrate. Hayaishi O, Kornberg A (May 1952). "Metabolism of cytosine, thymine, uracil
Uracil_dehydrogenase
DNA repair process
and hydrolysis of 5-methylcytosine to thymine, producing G:U and G:T base pairs. If the improper uracils or thymines in these base pairs are not removed
Base_excision_repair
Scientific study of genes at the molecular level
building blocks of DNA and RNA; made up of the nucleotides: adenine, guanine, thymine, cytosine, and uracil. His work on nucleotides earned him a Nobel Prize
Molecular_genetics
Chemical compound
and acts by transferring the ethyl group of ENU to nucleobases (usually thymine) in nucleic acids. Its main targets are the spermatogonial stem cells,
ENU
Dust floating in space
DNA and RNA organic compounds of life, including uracil, cytosine and thymine, have been formed in the laboratory under outer space conditions, using
Cosmic_dust
Disorder in which muscles fail to relax
expansion. The microsatellite expansion responsible for DM1 is of cytosine-thymine-guanine (CTG) triplet repeats, termed trinucleotide repeat expansion and
Myotonic_dystrophy
Self-contained, easily transported units used to purify water from untreated sources
thymine, one of the four base nucleotides in DNA. When a germicidal UV photon is absorbed by a thymine molecule that is adjacent to another thymine within
Portable_water_purification
Science of genes, heredity and variation
There are four types of bases: adenine (A), cytosine (C), guanine (G), and thymine (T). The phosphates make phosphodiester bonds with the sugars to make long
Genetics
Biomolecular structure of nucleic acids such as DNA and RNA
Nucleotides consist of 3 components: Nitrogenous base Adenine Guanine Cytosine Thymine (present in DNA only) Uracil (present in RNA only) 5-carbon sugar which
Nucleic_acid_structure
Microbial protein found in Escherichia coli str. K-12 substr. MG1655
group attached to DNA bases like guanine (O6-alkyl guanine) or thymine (O4-alkyl thymine) and to the oxygen of the phosphodiester backbone of the DNA.
Ada_(protein)
Chemical compound which is a modified DNA base
nucleic acid was found to be unusual, in that it contained in addition to thymine, guanine and cytosine, a methylated nucleotide. In 1925, Johnson and Coghill
5-Methylcytosine
Chemical compound
unmodified cytosine by Terminal deoxynucleotidyl transferase (TdT) or Thymine DNA glycosylase (TDG) by base excision repair. 5-Carboxylcytosine, along
5-Carboxylcytosine
Most common type of skin cancer
be BCC.[needs update] Overexposure to the sun leads to the formation of thymine dimers, a form of DNA damage. While DNA repair removes most UV-induced
Basal-cell_carcinoma
Class of enzymes
adenine dinucleotide phosphate (NADPH) as its cofactor. It can also act on thymine to give dihydrothymine. In humans the enzyme is encoded by the DPYD gene
Dihydropyrimidine dehydrogenase (NADP+)
Dihydropyrimidine_dehydrogenase_(NADP+)
Protein-coding gene in the species Homo sapiens
activity, acting on DNA mismatched DNA binding guanine/thymine mispair binding single thymine insertion binding Cellular component condensed chromosome
MSH4
Repetitive DNA with distinct base composition
produce a different frequency of the bases adenine, cytosine, guanine, and thymine, and thus have a different density from bulk DNA such that they form a
Satellite_DNA
Process of copying a segment of DNA into RNA
complement that includes the nucleotide uracil (U) in all instances where thymine (T) would have occurred in a DNA complement. Only one of the two DNA strands
Transcription_(biology)
THYMINE
THYMINE
THYMINE
THYMINE
Boy/Male
British, English
Son of Henry
Boy/Male
Indian, Punjabi, Sikh
Attain Union with God
Boy/Male
Hindu
Blue, With blue eyes
Boy/Male
Tamil
Female
English
English form of Latin Constantia, CONSTANCE means "steadfast."Â
Female
English
English variant spelling of Latin Angelina, ANGELLINA means "angel, messenger."
Surname or Lastname
English
English : nickname, perhaps ironic, from Middle English holy ‘holy’ + man ‘man’.
Girl/Female
Tamil
Tungabhadra | தà¯à®‚கபதà¯à®°à®¾
Name of a river
Male
Portuguese
Portuguese form of Latin Eugenius (2), EUGÊNIO means "well born."
Boy/Male
Hindu, Indian
Live as King
THYMINE
THYMINE
THYMINE
THYMINE
THYMINE